119 Comments
User's avatar
Her Indoors's avatar

'show us what's behind the black doors. We'll wait here.' Brilliant put down 👏👏👏👏

'Let's see where the public takes this.' Yep, all the way! 👏👏👏

I've not seen a time or subject when heavy duty scientists were explaining deeply complicated science research findings to us the public, we're lapping it all up, understanding the horrific implications and taking on the politicians, press, medics, neighbours , 'social media' and being part of a relentless revolution for deep change.

Keep going please Jessica! Remember always how much we hold you in high regard, listen to you, love your clarity of thought, learn and cheer loudly from all over the world 👏👏👏👏👏

Prof. Fred Nazar's avatar

#MonkeyGate: I'll soon post the full article.

Vaccines with monkey-virus, causing cancer

Conclusion

This is very technical, so the easy conclusion comes first.

Each human is an animal bio-computer BUT with an immortal soul. Instead of bits (zeros and ones), animals are wet programs based on four letters (A, G, C, T).

I really recommend this article to fully grasp the bio-computer/soul analogy:

https://www.catholic365.com/article/26130/dog-beats-artificial-intelligence.html

Biochemists and micro-biologists have become rookie bio-programmers using parts (sequences) from different viruses, like a computer programmer reuses instructions, algorithms, binary files and libraries, coded by prior programmers.

Unlike computers, which we built from scratch and have the detailed blueprints and know how they should work, lifeforms didn’t come with the Creator’s manual: we have the job to figure it out, reverse-engineering one word at a time.

The problem is that they are still clueless about many essential processes of the bio-computer, a bio-machine organized like a clock, so amazingly intertwined that, after 8 years of full-time med-school, a physician barely understands it.

Yet, there’s a big difference. If a progammer makes a mistake, he corrects it, and reiterates the process (re-run, reboot): no harm done.

The bio-programmers can’t even correct a botched gene-therapy: genes are altered for ever. If a bio-programmer makes a mistake, it could lead to a fatal error, not a blue frozen screen, not a bricked rooted phone, but human deaths. You can’t re-start a bricked human!

Even worse: if the coding mistake gets in the seminal cells, they are passed into future generations, not just that family tree, but eventually the whole human gene pool, since there’s currently no natural selection in humans.

SV40 is a dangerous carcingenic virus. There’s no prudence in hacking humans with SV40 sequences they don’t fully understand. They are pride monsters believing they are gods.

Nobody seems to be standing in their way, even if they deliberately make bio-weapons (bio-malware)!

SV40 in COVID haccines

Health Canada has written: “It was possible for Health Canada to confirm the presence of the enhancer based on the plasmid DNA sequence submitted by Pfizer against the published SV40 enhancer sequence.”

Like other polyomaviruses, SV40 is a DNA virus that has the potential to cause tumors by suppression of the transcriptional properties of tumor suppressor p53 in humans by the SV40 large T antigen and SV40 small T-antigen. Tumor suppressor p53 is responsible for initiating regulated cell death (apoptosis), or cell cycle arrest when a cell is damaged. A mutated p53 gene may contribute to uncontrolled cellular proliferation, leading to a tumor.” 1

The following explanation helps understand why it was added in Pfizer COVID haccines to cause turbo-cancer: “SV40 T-antigen uses a DNA shearing mechanism to initiate origin unwinding” 2 “The mechanisms of SV40 tumorigenesis in humans are related to the properties of the two viral oncoproteins, the large T antigen (Tag) and the small t antigen (tag). Tag acts mainly by blocking the functions of p53 and RB tumor suppressor proteins, as well as by inducing chromosomal aberrations in the host cell. These chromosome alterations may hit genes important in oncogenesis and generate genetic instability in tumor cells.” 3:

a) “SV40 large T antigen targets multiple cellular pathways to elicit cellular transformation” 4

b) “A fail-safe system to prevent oncogenesis by senescence is targeted by SV40 small T antigen” 5

New England Journal of Medicine study confirmed that viral promoter with SV40 sequence caused cancer: gene-therapy Skysona (eli-cel), caused blood cancer (e.g. leukemia) in 10% of patients 6, possibly more, since “more patients may appear over time” 7.

The drug had been 2022 FDA fast-track approved with a black box warning for the cancer “side effect”: in 2021 the FDA had put a clinical hold on eli-cel trials after the company, Bluebird Bio, found that the treatment caused a cancer-like condition in one patient, while two other patients were also being monitored for similar symptoms.8

“Stem cells are isolated and modified by using a lentiviral vector to add the ABCD1 gene9. The stem cells in bone marrow are killed with chemotherapy, and replaced with the modified stem cells.

Cause of cancer: Multiple off-target insertions, different ones for different people. Eli-cel causes cancer because it is:

- specifically done to stem cells, which are closer to cancer than usual

- applied to cells away from the immune system, which can often detect infections and kill infected cells early.” 10

The cases of cancer may have been driven by the design of the lentiviral vector used in Skysona: “using a lentivirus to insert a functioning form of the ABCD1 gene”: “a risk of that type of promoter (MNDU3) is oncogenesis, or driving the development of cancer, Duncan [lead author] explained” 11 The promoter plasmid12 has:

• SV40 ori: “The SV40 origin of replication comprises a run of thymine and adenine residues. Integrity of this AT-rich sequence is known to be essential for replication.” 13 “... interactions of simian virus 40 (SV40) large tumor antigen (large T) with the control region of the SV40 genome” 14 … “The simian virus 40 T tumor antigen (SVLT) induces replication of plasmids bearing the SV40 origin of replication (SV40 ori) within mammalian cells.” 15

• EBV Reverse, GTGGTTTGTCCAAACTCATC (Invitrogen), SV40 polyA terminator, reverse primer

• SV40 poly(A) signal, for “improved transcript life”16 “eliminated the inhibition induced by Alu14”17

• SV40pA-R, GAAATTTGTGATGCTATTGC, reverse primer SV40 polyA a “tool for accurate control of the relative expression levels of multiple genes. It has wide-ranging applications in fields related to the study of biosynthesis of multi-subunit proteins, proteomic research on protein interactions, and multi-gene metabolic engineering” 18 and directed evolution19.

• HIV-1 Ψ (psi) 20 for translation inhibition of HIV-1 full length mRNA.21

https://www.addgene.org/81071/

SV40 sequencing primers not used or not disclosed22:

SV40pro-F, TATTTATGCAGAGGCCGAGG, SV40 promoter/origin, forward primer

SV40-spliceR, CACAAAGATCCGGACCAAAG, SV40 splice sequence, reverse primer

pBABE 3', ACCCTAACTGACACACATTCC (Weinberg Lab), SV40 enhancer, 3' of MCS in pBABE vectors, reverse primer

OVID was designed as a primer for even more lethal COVID haccines:

https://scientificprogress.substack.com/p/the-real-covid-timeline

https://scientificprogress.substack.com/p/not-vaccine-not-gene-therapy-just

https://scientificprogress.substack.com/p/what-do-bioweapons-have-to-do-with

https://scientificprogress.substack.com/p/you-are-anti-haccine

The most important impact of the COVID haccines, population-wise, was infertility. Births dropped dramatically. Yet the infertility bomb will fully explode in 20 years: a huge percentage of the babies of the haxxed pregnants and the haxxed children could be infertile. If your unhaxxed children marry haxxed ones, they will probably not have children ... just as planned: the only choice deliberately left for them will be infertile DNA-designed transhumanized babies, for an ever dependency on immoral IVF (for every IVF-born, 25 are lost or murdered), with a prohibitive cost (planned increasing prices of carbon credit).

Ionedery2's avatar

Naomi Wolfe's new book mentions that Pfizer trials were all about reproduction and very little to do with respiratory disease. Del Bigtree finally went out on a limb and said it looks like an intentional pre-meditated attack on women, reproduction and humanity. A crime so huge and insane that few would even believe it was planned.

Her Indoors's avatar

All of which totally ignores the spiritual and energetic aspects and implications. They're massive. Thomas Meyer Spiritual Implications of the Coronovirus Vax.

In my experience the aura is totally destroyed. We're living in a zombie world. Read the signs - road rage and aggression is growing rapidly. Again my experience is drivers ignoring Give Way signs then reacting that they have the right to do so ....etc Pandora's Box is wide open

Viking's avatar

Why is there still nobody doing autopsies on the bodies with the abnormal clotting issues that have never been seen before by embalmers before the rollout of the Covid bio weapon injections!!!!!!!!!!!!!

Laura Kasner's avatar

Viking - that’s a very good question. Those clots are also being found in the living.

https://laurakasner.substack.com/p/results-of-the-peoples-blood-clot

Alison Rowe's avatar

If the TGA and others are so insistent that these scientific findings are “misinformation” and are causing “vaccine hesitancy “ I simply cannot understand why they are unable to produce the counter evidence….and the missing data. Furthermore, how is it that humans cannot see just how ridiculous it is that they don’t do that….and that the political response of reporting the mantras “it’s misinformation” “ vaccines are safe and effective “ is just so weak, tired and pathetic and quite patronising to any individual with an ounce of intelligence? 😡

John Alton's avatar

They should be particularly concerned now that Naomi Wolf's new book: "The Pfizer Papers: Pfizer's Crimes Against Humanity" has been published. They should be particularly concerned with the revelations starting at the 19 minute mark, of this interview with Del Bigtree, where she outlines how Pfizer's own documents seemed to indicate they are more interested in reproduction than respiratory issues. She also mentions that woman had far more adverse events than men. https://thehighwire.com/ark-videos/dr-naomi-wolf-reveals-shocking-details-in-the-pfizer-papers-2/

Chiadrum's avatar

Because people are desperate to believe the demented consensus. If the consensus were wrong, that means they were bamboozled and poisoned themselves and their families for no reason whatsoever.

Alison Rowe's avatar

Sadly I think you are correct which increases my despondency

Warrior Mom's avatar

yeah well, THEIR BS is what's turning 'vaccine hesitancy' into 'vaccine HELL NO'.

LiquidMSL's avatar

From the start… I called bs back in 2020 when they threatened any Dr. who prescribed a Nobel prize winning medication with proven results and safety record in treating Covid-19. My thought was The NIH (FknFouchi) was obviously willing to put Pfizer’s profits above every person on this planet’s health. Straight up Criminal behavior.

Deb Robinson's avatar

For the first time in 4 years I feel proud of a group of elected officials finally standing up for Australians in the face of the Goliath of tyranny we have endured in regards to these despicable, killer pharmaceutical products and the dreadful mandates and lockdowns forced upon us. Let this go viral, let our governments be shamed into backing down. This will hopefully bring more light to the darkness.

Her Indoors's avatar

And even yet, it wasn't unanimous. Strange but not strange. 🤷

Gogs's avatar

One of the most depressing aspects of the last few years is the realisation that the world is indeed overrun with utterly shameless charlatans. But on the bright side, we see them these days, and they're really not very good at it.

Ralph's avatar

This response from the TGA stinks of corruption. I cannot believe that they sincerely believe what they say, or they would be completely transparent with their tests. It's shocking to see their shamelessness, but it shows that they have been emboldened by getting away with their corruption for a long time.

Keep up the good fight, Jess!

Jaime Jessop's avatar

As you say:

"The TGA are referring to rigorous and reproduced science as 'misinformation'. This concerns all of us and although this is not surprising, it is alarming."

This goes to the heart of the matter. The powerful and entrenched establishment's knee jerk response to actual science and data (not just in the Pharma/medical field, but in other areas of science too, notably climate science/meteorology) is to attempt to dismiss hard data and the irrefutable interpretation thereof as 'misinformation' or even 'disinformation'. This is indeed not surprising because it is all they can do when confronted by such damning evidence which even the 'fact checkers' would have an impossible task refuting. It is alarming because 'misinformation' when quoted by the establishment is the clarion call to sledgehammer censorship. We are in an information war: Goliath knows that the only way he can win is to deflect David's targeted slingshot information by erecting a global censorship barrier - and that is what Goliath is going for, but David's information keeps slipping through that leaky net, thanks to sites like X and Substack. Pretty soon, Goliath is going to get really, really angry.

Marty Ellenbecker's avatar

THERE WILL BE NO SOLUTION until these disease perpetrators suffer and die like their victims. Institutional Justice is A.W.O.L.!

. .

There is no moral issue. Fauci, Baric, and the worst of them fit both the

standard and medical dictionary definitions of pathogens.

In the health field, it is both established precedent and standard operating procedure to kill pathogens to prevent human deaths.

. .

These cloven-hooved bastards have created and established 2 ENTIRELY NEW CRIMES,

not merely against humanity, but against its emergence and existence.

They have not only sabotaged the womb, where life originates,

but the genome which enables, guides, maintains, protects and assures

human survival and proliferation.

. .

If you don't take the gloves off, the undertaker will.

Ionedery2's avatar

Strong words, but true. They won't or can't see the incredible harm. Infuriating. Anti-human. Irresponsible. Do they believe their own lies I wonder?

RussCR5187's avatar

That's why I think the word "psychopath" is also needed. By definition, psychopaths are incapable of empathy. They have no guilt or remorse over the harms they cause others.

Elaine's avatar

I think there needs to be a new definition of psychopath because the current one simply does not adequately describe these people actions.

Ionedery2's avatar

A corporation has no empathy or remorse. Profit and growth are the goal. Is this the death of Capitalism/corporatism? The wealthy, the powerful are psychopathic? If so, then how do we change this faulty system before it harms us to the point of no return I wonder. As we witness the collapse of trust, integrity, morals, empathy and human decency at the highest levels, the winds of change are upon us. It's reached it's limit now and is I think, unsustainable. Like a feedback mechanism in a natural system the narrative is changing, cracks are appearing as people wake up. A giant complex system of wealth and control is at odds with life itself and it's breaking up. It's going to implode until a new paradigm emerges.

RussCR5187's avatar

I don't disagree with your general analysis. I believe corporations to a certain degree take on the personality of their highest-positioned leaders. Companies can be as psychopathic as their leaders ruthlessly drive them to be. Most middle managers don't want to lose their paychecks, so they cave.

And why do so many psychopaths rise to the very top? Because they don't care who they have to run over to get there.

Elaine's avatar

Think of all of the cons and scams over history. When nothing matters but perpetuating the con because you benefit from it, you don't care that you are hurting other people.

Anita Söderman's avatar

Thank you Jessica for these revelations, and in Australia too by David Nixon. Why are we not surprised at the reactions? AUSSIES have been worse treated than many of us and can well do with some excuses instead....

B Dollen's avatar

W.H.O. IS FIGHTING THE RELEASE OF DEADLY INFORMATION ON CV-19 iNJECTIONS IN AUSTRALIA & NEW ZEALAND…????????

B Dollen's avatar

“WORLD” XHEALTH ‘ ORGANIZATION ’ / B I L L G A T E S … SON OF A LEADING “ FREEMASON” FAMILY …!!!

B Dollen's avatar

— ALWAYS … ‼️‼️‼️‼️‼️

B Dollen's avatar

- MASONS = DEMONIC

B Dollen's avatar

— A M E R I C A — AND,

G O D ….!!!!!

Jen's avatar

Is anyone else tired of that word “misinformation “? For me it signals that something true has been said. And the user of the phrase “misinformation “ wants to suppress the true statement. *

*Referring to the TGA calling the report misinformation…

Kat Bro's avatar

I think it's purposely meant to sound infuriating except to those who look down their noses and use it. Kinda like narrative 🤮.

The BarefootHealer's avatar

They can't show you behind the "black doors", because the "black doors" were given to them by Pfizer and Co. The TGA/FDA and etc, essentially did not do their own homework, they know they didnt, and they are trying to avoid being busted for "copying" their homework from the companies that they are supposed to be regulating. It goes towards "...warp speed." You dont get warp speed by actually following procedure!

They will continue to prevaricate until they have been able to "produce" the missing homework. In which time, I suggest revisiting the "time/date stamp protocols for official documents.

Methinks, someone at the TGA is about to have a sudden retirement with full benefits, and a watertight NDA.

#regulatorytapdance #regulatorycaptured #dontbuytheBS #mistakeswereNOTmade

BTJMO

Garry Blankenship's avatar

It is very homocentric to believe we can improve upon thousands of years of the natural development of our immune systems in a matter of a few years. A real travesty is our legal system providing excessive profit to patents while simultaneously disallowing the patent of natural substances. We have driven health into the jaws of greed, it's inevitable corruption and the almost exclusive development of unnatural substances.

SeeingTruth's avatar

Excellent dissertation of all the lies "they" keep attempting to cover up. Easy to understand!!! Jessica, you knocked it out of the park!

PharmedOUT's avatar

What appears to be democide continues, no absolute inference here in this comment, however, how many years will this go on? Is it ever going to stop? Also, what about what the “Vaccine Safety Research Foundation’s” (VSRF, Steve Kirsch) report earlier this week, in their weekly virtual meeting, that “SA-mRNA” (self amplifying, or self-replicating, mRNA “shots” in Japan, are starting to be used?) ..That was my understanding from listening to the meeting, and the main speaker was a doctor (PhD), from Australia (his name escapes me, at the moment) ..If anyone is interested, I could look his name up ..

Andy's avatar

I read the statement “biotechnology has been used in medicines since the 1980’s”. This is a truly incorrect representation. It is like CDC changing the definition of vaccine to eliminate hesitancy to accepting an experimental gene therapy. In the 1980’s biotech was used to produce a product identical to the original product in the end. Biotech was used to synthetically produce insulin at that time. The product of which is identical to the originally used product, harvested from pigs. Biotech products have never been used to inject humans with proteins (eg Spike) that reproduce in the body as in the mRNA shots… they are not now and never will be real vaccines.

Regarding the Guelph lab…it is certified as the University is an accredited research university. Those grasping for straws in Australia to discredit fact or truth, who have no understanding of science, molecular biology or anything for that matter should go pound sand! They should also be charged with assault causing bodily harm and murder!

Kat Bro's avatar

My SIL got the notion that MRNA has been used in vaxs for decades so it's safe! She is one to tout the latest propaganda so who knows where she heard that?

Her Indoors's avatar

My neighbour in December 2020 on her way to be jabbed told me angrily when I quietly questioned her actions that 'they'd been tested and tested'. Where did she get that idea from? Ex nurse. TV fanatic. 🤷

Kat Bro's avatar

I had a nurse ex friend sound off on the it's CRISPR technology! It's been in trials for 20yrs! Yeah she forgot the part about all the test animals perishing.