As Michael Yeadon writes, no way are these "vaccines" accidental in their pathology. It has been long known that the spike IS the toxin that is causing all the damage of the covid virus. Yet all 3 companies decided to use spike as the TARGET.
And they recommended it for EVERYONE, including pregnant women. That has NEVER happened before.
Read watch Yeadon. He explains it concisely.
You are a ROCK STAR Jessica. Looking back, we will not be ignorant of the evidence of criminality, mens rea, and the amount of deviousness that went into engineering this bio weapon.
Wow. Yeah, Yeadon breaks it down,all the "mistakes". Mistakes like similarities to prions (or maybe that was Jessica?) similarities to other cells or items in our body leading to auto immune diseases. The huge increase in cancers, both new cancers and cancers coming out of remission has to do IIRC to our immune system
it seems clear this is planned. although what's the precept to never blame evil if stupidity is just as likely. Our upcoming food shortage was certainly planned and it's too diverse for any one government to do. Nitrates restriction in many countries. Somebody put up article where Rockefeller Organization predicted this in IIRC Mar 2020. I hope we can raise awareness of this this year, maybe like Holland and Syra Lanka are doing. They aim for millions to die and humanity to lose ability to organize to fight. Seems similar to Hunger Games. I obviously hope they are wrong and people to rise up like in France early 1800s. I know that was a terrible time but it seems humanity is in same situation as flight 93 and it's time to ROLL.
So, to put this in laymen's terms, we are screwed. We need to stop these injections but the money and power has so overcome all ethics and morals that it seems unstoppable. What will it take to stop it? I assume it has to be a complication in one of our elite rulers or in their families. Celebrity complications were not enough. We just make up a new category of sudden death of unknown causes.
Dr Rose. I hope you see this as I’m interested in your take. A colleague of mines wife had a baby last week. He is Pfizer x 2 wife is not but shedding = big concern bc she got pregnant right before his shots. Found out today baby’s test for SCID came back abnormal. He has no family history of anything close to this type (80% don’t according to NAIAD but who trusts them anymore?) OF COURSE they gave her the Hep-B vaccine right out of the womb. This is a rare disorder but I’m wondering if there has been any signals in VAERS that you have seen with regard to abnormal tests pari natal in this regard? Obviously we don’t know for sure what it is yet as more tests need to be done to rule out / verify a diagnosis but I wanted to get a head start.
I assumed that too, but I’m starting to wonder how many of these people are getting the real jabs. Gavin Newsom disappeared for 2 weeks after his moderna booster and missed the global warming conference in Scotland. Supposedly he had slightly more wrinkles on one side of his face, indicative of Bells Palsy. NM senator Lujan had a stroke. Not sure if it’s jab related but 49 is kind of young for a stroke. FauXi has been on paxlovid for 26 days. He might still have covid symptoms. I thought holy cow! He actually believes in this snake oil. Maybe he really got 4 jabs.
Though we may not understand how in the present moment, truth and right will always win in the end. Taking a stand for truth and right regardless of personal consequences is essential. Better to be dead right in the war against evil, than to be dead wrong as Arnold eloquently states.
Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least *FOUR* Distinct Functions. Coincidence?
Unpacking the evil genius of TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT
(ribosomal pausing site plus the furin site, enterotoxin peptide superantigen, & HIV motif)
Also the reckless vax codon optimization throughout the entire spike genome screws up the translation integrity somewhat, producing lots of ugly brutish deformed mutant Franken-spikes (that are way less efficient at infecting cells, they tested that out by letting them assemble on cute little psuedovirions, the ones with the mutant "spikevax" were far less efficient despite also being more numerous (ie greater reservoir of available mutant spikes translated compared to native Wuhan GoF optimized spike w/o the vax codon optimization & ribosomal pausing site))
I haven’t even read this yet but Bret Weinstein has been talking about lab created varients. Nothing surprises me anymore in the world we are experiencing. Your a rockstar 💜
I would have given anything to have had the slightest understanding of all of this when I was advocating for my dying father. Cytokine storm put him into the hospital Aug 2021 (first 2 jabs early 2021). They “put the fire out” and he went home but on dialysis. Improvement continued! Needed his still inflamed gall bladder removed in Oct before coming off dialysis. Had a 3rd jab 2 weeks before surgery. Surgeon cut the wrong duct which is tough recovery on an already taxed immune sys. Accidental 4th jab two weeks after that (3rd jab was recorded funny on his vax card, we think they overlooked it and gave him another one month later)…a cascade of failures ensued and on his final days electrolyte imbalance had him demented with his fluid weeping from his periphery: spike+RAAS
:-( I kept asking doctors if this could all be from these BS vaccines. They looked at me like I had 3 heads. I’m furious but finally understanding some pathophysiology actually brings weird closure. Thank you JR for your tireless efforts and explanation.
Some of the other best and brightest censored voices & familiar faces are on the same page with you. Charles Rixey & JJ Couey Gigaohm Biological 4 July 22
Thanks for the update. Many of us expressed concern about what was early on called the piece inserted from the AIDS virus which would result in these massive problems
"woe to the inhabiters of the earth and of the sea! for the devil is come down unto you, having great wrath, because he knoweth that he hath but a short time." (Revelation 12:1 KJV)
Thanks for posting this David. It has been mentioned here and elsewhere that the folks behind this pandemic seem to be in a big hurry. Which points to your above quote;
... (they) he knoweth that he hath but a short time."
Hello Jessica, I believe that this new paper out of Germany is another key piece of the big picture as to what these repeated spike-based mRNA injections are doing to our immune systems. I hope you can look at it and give us more insight into the double-edged sword nature of the emergence of IgG4-type antibodies;
In a nutshell, the authors tested for IgG1-4 balance of antibody types across different vax + infection cohorts, and found that after vax #3, i.e. booster, many of the injected were now class converting to IgG4, which is a known sign of a kind of antigen overload. The long-lived, pseudouridine capped mRNA is doing its job way too well.
IgG4 is not good as you know.. it means our immune system is tapping out from it's normal functions. The below paper, published just prior to the mRNA injection campaigns looked at IgG types and did not see signs of elevated IgG4 from natural infections, so this phenomenon seems tied to the injections, and in a dose dependent manner;
I wanted to make sure everyone knew the relevance and importance of the enhanced destructiveness role of these 4 little amino acids. It makes this spike thing so much worse and you should know that in the referenced paper #3, the version of spike with a PRRA mutant not only attenuated disease in the hamsters they were studying, but yielded robust protection from SARS-CoV-2 re-challenge.
The first half of the paragraph seems to suggest a bad thing ("enhanced destructiveness"), but the second half of the paragraph suggests a good thing ("attenuated disease", "robust protection"). Can you remedy what sounds like a contradiction to me and clarify my confusion?
I looked up the paper and please reference the last paragraph of the introduction - they were using a PRRA mutant (the furin cleavage site was missing that's what the delta symbol means) so missing furin cleavage site = less disease & robust protection against future disease: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7457603/
I haven’t heard or seen much on the injection time table… 21 days moderna… 28 days phizer… these are correlated with woman’s menstrual cycles. Has ANY research been done on this??
As to your headline, "How is everyone not talking about this paper?", it seems that many publications are tending toward slow-walking lots of articles. Maybe this is just me and my less than "up to date on the current literature" in my retirement but I just feel like things are not happening at the usual and needed rate. Admittedly, I read far more classical "medical journals" than Jessica Rose type journals.
This hits home in a big way for me. My now 11 year old nearly died in February 2021 from MIS-C. There is so much information available on Covid, vaccines, etc. but almost no one in these substacks has written much on MIS-C. My previously healthy daughter (10 at the time) was in the cardiac ICU. Here were just a few of the things she went through: heart failure, thrombocytopenia, acute kidney injury, breathing problems, myocarditis showing enhancement on her MRI, 3 months of Anakinra shots, steroids. Hard to really even put into context the hell she has endured due to this man made virus. For 17 months since, I have poured through medical journals, books, everything I can find for any answers as the doctors pretty much gave us nothing other than constant pressure for over a year to vaccinate as the antidote to MIS-C. Since I have a brain, we did not and will not. Anyway, thank you for posting this. I have done a lot of reading on sepsis, superantigens and noticed that my daughter fit into that category. I still don’t understand exactly why her body had this particular reaction, but I will do everything in my power to continue her healing journey.
As Michael Yeadon writes, no way are these "vaccines" accidental in their pathology. It has been long known that the spike IS the toxin that is causing all the damage of the covid virus. Yet all 3 companies decided to use spike as the TARGET.
And they recommended it for EVERYONE, including pregnant women. That has NEVER happened before.
Read watch Yeadon. He explains it concisely.
You are a ROCK STAR Jessica. Looking back, we will not be ignorant of the evidence of criminality, mens rea, and the amount of deviousness that went into engineering this bio weapon.
Actually, it was 4 drug companies, not 3, which makes it even more likely there was malignant intent.
Wow. Yeah, Yeadon breaks it down,all the "mistakes". Mistakes like similarities to prions (or maybe that was Jessica?) similarities to other cells or items in our body leading to auto immune diseases. The huge increase in cancers, both new cancers and cancers coming out of remission has to do IIRC to our immune system
it seems clear this is planned. although what's the precept to never blame evil if stupidity is just as likely. Our upcoming food shortage was certainly planned and it's too diverse for any one government to do. Nitrates restriction in many countries. Somebody put up article where Rockefeller Organization predicted this in IIRC Mar 2020. I hope we can raise awareness of this this year, maybe like Holland and Syra Lanka are doing. They aim for millions to die and humanity to lose ability to organize to fight. Seems similar to Hunger Games. I obviously hope they are wrong and people to rise up like in France early 1800s. I know that was a terrible time but it seems humanity is in same situation as flight 93 and it's time to ROLL.
So, to put this in laymen's terms, we are screwed. We need to stop these injections but the money and power has so overcome all ethics and morals that it seems unstoppable. What will it take to stop it? I assume it has to be a complication in one of our elite rulers or in their families. Celebrity complications were not enough. We just make up a new category of sudden death of unknown causes.
yes.
Dr Rose. I hope you see this as I’m interested in your take. A colleague of mines wife had a baby last week. He is Pfizer x 2 wife is not but shedding = big concern bc she got pregnant right before his shots. Found out today baby’s test for SCID came back abnormal. He has no family history of anything close to this type (80% don’t according to NAIAD but who trusts them anymore?) OF COURSE they gave her the Hep-B vaccine right out of the womb. This is a rare disorder but I’m wondering if there has been any signals in VAERS that you have seen with regard to abnormal tests pari natal in this regard? Obviously we don’t know for sure what it is yet as more tests need to be done to rule out / verify a diagnosis but I wanted to get a head start.
You'll never convince me that the people organizing this are taking their own poison. They plan on surviving their assault on humanity.
They want to reduce the population of *other* people.
for sure they're not. unless they're meant for termination as well.
well, Biden can only be a puppet. . . likely before being successfully impeached he will be taken out . . .
I often wondered what would turn up if there were to be "blood test raids" on Fauci and other cover-up perpetrators
Absolutely agree.
https://www.dailymail.co.uk/news/article-9333157/Pfizer-CEO-Albert-Bourla-cancels-trip-Israel-hes-not-fully-vaccinated.html
I assumed that too, but I’m starting to wonder how many of these people are getting the real jabs. Gavin Newsom disappeared for 2 weeks after his moderna booster and missed the global warming conference in Scotland. Supposedly he had slightly more wrinkles on one side of his face, indicative of Bells Palsy. NM senator Lujan had a stroke. Not sure if it’s jab related but 49 is kind of young for a stroke. FauXi has been on paxlovid for 26 days. He might still have covid symptoms. I thought holy cow! He actually believes in this snake oil. Maybe he really got 4 jabs.
Or. Maybe it is his plausible denial when the s!t hits the fan. (Read that on another substack. Sounds about right for that snake!)
These kinds of articles are showing up all over. Of course, many of our rulers aren't touching this vaccine. You are right.
https://europeanconservative.com/articles/news/thousand-of-spaniards-named-in-fake-vaccine-certificate-scandal/
Charge once more then, and be dumb!
Let the victors, when they come,
When the forts of folly fall,
Find thy body by the wall.
The Last Word, Matthew Arnold
Though we may not understand how in the present moment, truth and right will always win in the end. Taking a stand for truth and right regardless of personal consequences is essential. Better to be dead right in the war against evil, than to be dead wrong as Arnold eloquently states.
I wrote up the observation made to me by an NIH scientist that the spike has one awfully power-packed segment that incorporated these characteristics.
https://ashmedai.substack.com/p/gain-of-function-smashing-success
Gain-of-Function Smashing Success: The Key Sequence Inserted in the SARS-CoV-2 Virus Added at Least *FOUR* Distinct Functions. Coincidence?
Unpacking the evil genius of TATCAGACTCAGACTAATTCTCCTCGGCGGGCACGT
(ribosomal pausing site plus the furin site, enterotoxin peptide superantigen, & HIV motif)
Also the reckless vax codon optimization throughout the entire spike genome screws up the translation integrity somewhat, producing lots of ugly brutish deformed mutant Franken-spikes (that are way less efficient at infecting cells, they tested that out by letting them assemble on cute little psuedovirions, the ones with the mutant "spikevax" were far less efficient despite also being more numerous (ie greater reservoir of available mutant spikes translated compared to native Wuhan GoF optimized spike w/o the vax codon optimization & ribosomal pausing site))
that was great.
Thanks sm :)
I haven’t even read this yet but Bret Weinstein has been talking about lab created varients. Nothing surprises me anymore in the world we are experiencing. Your a rockstar 💜
Thank you to all the truth warriors. My eyes are burning with tears of frustration.
I would have given anything to have had the slightest understanding of all of this when I was advocating for my dying father. Cytokine storm put him into the hospital Aug 2021 (first 2 jabs early 2021). They “put the fire out” and he went home but on dialysis. Improvement continued! Needed his still inflamed gall bladder removed in Oct before coming off dialysis. Had a 3rd jab 2 weeks before surgery. Surgeon cut the wrong duct which is tough recovery on an already taxed immune sys. Accidental 4th jab two weeks after that (3rd jab was recorded funny on his vax card, we think they overlooked it and gave him another one month later)…a cascade of failures ensued and on his final days electrolyte imbalance had him demented with his fluid weeping from his periphery: spike+RAAS
:-( I kept asking doctors if this could all be from these BS vaccines. They looked at me like I had 3 heads. I’m furious but finally understanding some pathophysiology actually brings weird closure. Thank you JR for your tireless efforts and explanation.
Some of the other best and brightest censored voices & familiar faces are on the same page with you. Charles Rixey & JJ Couey Gigaohm Biological 4 July 22
https://newtube.app/user/Fredyatelmstreet13/pg9NDWk
Thanks for the update. Many of us expressed concern about what was early on called the piece inserted from the AIDS virus which would result in these massive problems
The devil's fingerprints are all over this.
"woe to the inhabiters of the earth and of the sea! for the devil is come down unto you, having great wrath, because he knoweth that he hath but a short time." (Revelation 12:1 KJV)
Thanks for posting this David. It has been mentioned here and elsewhere that the folks behind this pandemic seem to be in a big hurry. Which points to your above quote;
... (they) he knoweth that he hath but a short time."
Yes. It seems full onslaught
Hello Jessica, I believe that this new paper out of Germany is another key piece of the big picture as to what these repeated spike-based mRNA injections are doing to our immune systems. I hope you can look at it and give us more insight into the double-edged sword nature of the emergence of IgG4-type antibodies;
https://www.medrxiv.org/content/10.1101/2022.07.05.22277189v1
In a nutshell, the authors tested for IgG1-4 balance of antibody types across different vax + infection cohorts, and found that after vax #3, i.e. booster, many of the injected were now class converting to IgG4, which is a known sign of a kind of antigen overload. The long-lived, pseudouridine capped mRNA is doing its job way too well.
IgG4 is not good as you know.. it means our immune system is tapping out from it's normal functions. The below paper, published just prior to the mRNA injection campaigns looked at IgG types and did not see signs of elevated IgG4 from natural infections, so this phenomenon seems tied to the injections, and in a dose dependent manner;
https://www.medrxiv.org/content/10.1101/2020.12.18.20248461v1.full.pdf+html
I am confused by the following paragraph:
I wanted to make sure everyone knew the relevance and importance of the enhanced destructiveness role of these 4 little amino acids. It makes this spike thing so much worse and you should know that in the referenced paper #3, the version of spike with a PRRA mutant not only attenuated disease in the hamsters they were studying, but yielded robust protection from SARS-CoV-2 re-challenge.
The first half of the paragraph seems to suggest a bad thing ("enhanced destructiveness"), but the second half of the paragraph suggests a good thing ("attenuated disease", "robust protection"). Can you remedy what sounds like a contradiction to me and clarify my confusion?
yes non-mutant for former and mutant for latter. the mutation or delta of the sequence makes it less dangerous
I looked up the paper and please reference the last paragraph of the introduction - they were using a PRRA mutant (the furin cleavage site was missing that's what the delta symbol means) so missing furin cleavage site = less disease & robust protection against future disease: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7457603/
Don't be afraid to dig for answers yourself!!
Wow! So SARS-2 and the Vax spike both contain AIDs inserts and a staph enterotoxin insert?
I haven’t heard or seen much on the injection time table… 21 days moderna… 28 days phizer… these are correlated with woman’s menstrual cycles. Has ANY research been done on this??
As to your headline, "How is everyone not talking about this paper?", it seems that many publications are tending toward slow-walking lots of articles. Maybe this is just me and my less than "up to date on the current literature" in my retirement but I just feel like things are not happening at the usual and needed rate. Admittedly, I read far more classical "medical journals" than Jessica Rose type journals.
:) times they are a-changin'
Why isn't it, indeed. I read about this several months ago, but in a 3rd-hand report without much detail.
Since gain-of-function perpetrators will do gain-of-function, another question is - Why would Fauci take a weaponising project to a Chinese lab?
Would it have anything to do with DARPA turning down a request by Eco Health Alliance' s proposal to do the same thing? They deemed it too dangerous.
Looks like he was evading the watchdogs stateside, or has an "alternate allegiance".
Either way, this may be bundled into the overall cover-up.
This hits home in a big way for me. My now 11 year old nearly died in February 2021 from MIS-C. There is so much information available on Covid, vaccines, etc. but almost no one in these substacks has written much on MIS-C. My previously healthy daughter (10 at the time) was in the cardiac ICU. Here were just a few of the things she went through: heart failure, thrombocytopenia, acute kidney injury, breathing problems, myocarditis showing enhancement on her MRI, 3 months of Anakinra shots, steroids. Hard to really even put into context the hell she has endured due to this man made virus. For 17 months since, I have poured through medical journals, books, everything I can find for any answers as the doctors pretty much gave us nothing other than constant pressure for over a year to vaccinate as the antidote to MIS-C. Since I have a brain, we did not and will not. Anyway, thank you for posting this. I have done a lot of reading on sepsis, superantigens and noticed that my daughter fit into that category. I still don’t understand exactly why her body had this particular reaction, but I will do everything in my power to continue her healing journey.