Dear Dr Rose. I read your most recent email commentary on epigenetics. (I am a medical doctor -- a non-scientist by fault of having gone through medical school and two residencies -- and long deprogrammed by just learning to question things!) I just wanted to chime in and say that i love your posts. I love the education you're giving all of us. And I love your courage to step out and speak out. Thank you, dear doctor! The information you have given me, along with people like Steve Kirsch, Joseph Mercola, Pierre Kory, Peter McCullough, and others, have been a god-send to a "country doctor" like me who needs the science to back up my anti-SARS gene jab education to my patients, and to some of my deaf colleagues. I appreciate you so much, all the way down here in Texas. Dr Ron
This is a great article, thank you Jessica. I'm sharing far and wide. I really appreciate the added graphics and videos ;-) ....really helps those of us who are far less "science minded" peeps.
I think we are all still stuck on the idea that the Japanese worker just coughed his flu bugs into Homer’s juicer and wanting to know the outcome of this dastardly event. Everything else is just so complicated. 😂 Kidding aside what a horrifying article Dr Rose. Makes me glad I’m not injected! Thank you!
I suspect the author retracted his article on DNA repair after the Davos gang made him an offer he could not refuse. When Michael Corleone realizes what has happened to him and his kids and grandbambinos, I would not be surprised if Billy wakes up one morning to find Klaus and Tony's heads next to him under the sheets. (of course I cannot condone this but I would understand).
Aug 16, 2022·edited Aug 16, 2022Liked by Jessica Rose
Thanks for this article. As a layman who has been reading about epigenetics, mitochondrial disease, chemical mutagens and systemic inflammation for the last five years or so. The jabs scared the shit out of me for this reason.
Epigenetics is complicated. Small causes have large effects and this drug by its design looks like it is full of those small causes, lots of them. And without a crystal ball who knows what will eventuate. Cancers. Birth defects. Metabolic diseases. Chronic fatigue.
Jessica, This is an excellent piece as is most of your work. Generally apocryphal academic MD here (tenured so hard to assail) who has been a long-time journal editor. Want some copy editing? Would be happy to do so. But for starters, it is "alluded" not "eluded"... :) Thanks for all you do. These long-form and referenced pieces are hard to write.
I haven't yet read your article, but I do know that the spike in the vaccine (and possibly the spike in the virus itself) will tend to cause chronic systemic inflamation. Such inflamation is a strongly contributing factor to most or all of the diseases of old age -- cancer, Alzheimers, arthritis, cariovascular, et al.
The ENTIRE spike (epecially the NTD domain) should NEVER have been used in the vaccine.
One of the many deliberately concealing actions of one of the Trial organizers (with either the BioNTech or Moderna vaccine) was to kill the mice or rats two weeks after the observations, thus preventing any feedback about long-term adverse (or beneficial) effects. For this, we will be including them among the possible Nuremberg Trials II defendants. If it was a deliberate effort to make sure the vaccine was approved, rather than mere stupidity, then we will include them as defendents.
As always, I thank you, Jessica, for your insightful work, and I look forward to reading this particular article tonight.
One thing that anti-vaxers (most of whom lack scientific knowledge) intuitively understand is that "too much of a good thing is bad." The neuro-microbiota-immune system is incomprehensibly complex. And all the diseases of old age are adversely affected by out-of-balance or out-of-control immunity. Therefore, one vaccine (let's say, smallpox) is extraordinarily good. Two (let's say, polio) are also very good. Three, good. Four, good. Five... we need to begin questioning, not the effect of ANY ONE but rather the effect of ALL on the organism's health. Twenty or thirty? Really!
Here, as everywhere in biology, what matters is the entire network. Not an individual node. The anti-vaxers (idiot-savants, perhaps?) intuitively understand this. The knee-jerk lemming little fascists, not so.
On topic of inflammatory disease, you once made reference to curing your own “illness induced asthma”. Could you please share that approach sometime? Our young children have “illness induced asthma” and use Flovent/Albuterol inhalers during cold season. They had regular US vax schedule until age 7 (no Covid vax). Would be very grateful to research alternative therapies for this condition. Thank you for your tireless efforts to educate others!
At first I thought Fauci et al were just ignorant fools. Now, with your research, I realize it started way before public health got involved. Were the researchers, I doubt were idiots, told to ignore certain aspects of the research, actively hide it, or did they really just miss it. I think we can be pretty sure they didn't miss the potential problems. Either of the two remaining would be possible especially with one of my favorites," we were just following orders." Could there have been studies altered before final release? Dr. Rose thank you for all the work.
scientists are saying they are finding random snippets of genetic code in the shots. Imagine this horror story.
Within the vax injectable genetic drug, the manufacturer inserts a number of random codes. ATCAGTCAGGGTGAACTGGGTGG. CCATGGGTACTGATCTAGGCATTGATCTA. ETC…(etc is not a gene code by the way) just trying to make you smile.
Thanks for reading shawn663@substack! Subscribe for free to receive new posts and support my work.
At a future date they want to trigger another pandemic, you know drive the share price.
An incident is promoted by media, WHO/Gates or WHOmever. This time the dreaded ATCAGTCAGGGTGAACTGGGTGG is the terrible code phrase. All are on high alert set your VCR for above mentioned code sequence. If this is found in the test then we can say a positive result. Naturally it will be found we put it there.
Oh my goodness a new pandemic, different codes for different continents/countries, you know just for variety organized by lot number, do we need a librarian?.
Goodness new lockdowns, new/old vaccines. Hold on Hold on we don’t even need a new vax. Its just random code we installed in the previous shot. A three dressed up as a nine you might say. Just add water to the old vax, instant potatoes so to speak(thats the proper spelling Clinton Foundation) more deaths from social isolation, more profits, this years lambourgini(?).
Great Jimminy Cricket zippidy do da zippidy yay, what a wonderful day.
Impossible,,hmmmmm injecting kids with a pseudo vax that can have serious outcomes including death,,,,now thats impossible! These guys are peeing me off.
Did I say VCR meant to say PCR but it really is a horror movie. ok ok stand up aint my thing.
I have a screen writer friend maybe a movie here,,, we can all star as the good guys you know the natural human immune system, I call T Cell.
IVERMECTIN/HYDROXY work, we knew, the WHO knew, when did they know, who suppressed it.
Are you able to obtain the original peer review of the Hui Jiang article? Occasionally I have seen the entire review and revision commentary and, for a non-specialist, it added considerably to my appreciation of the article.
Thank you for pointing us to Stephanie Seneff + glyphosate + shikimate pathway
Really can't thank you enough. I have learned some about this disaster over the years. Now I can find it all in nearly one place. Nice to add her name to Rachael Carson's.
In the USA late 1960s early 1970 our health and longevity was about 4th in the world. Now it is 79th and falling like a rock. By scanning some articles by Stephanie Seneff I saw that glyphosate was introduce to the world in 1974. My speculation at the moment is it may be a primary cause for the dramatic decline in health in the USA and most likely the world.
A particularly disturbing trend is to eliminate the control group. Mass injectable therapeutic gene therapies do this by compelling` everyone on the planet to be jxbbed. No outliers. It appears to have already happen with glyphosate without anyone being alerted to this process and no control land, air and water ways set aside as safe havens/control groups or groups of people who could truly opt out of being poisoned.
You have been slandered by Droit (I hope I spelled her name right) and it was compared and rightly so to rape or as the good doctor said "gang rape". What the hell is glyphosate if it isn't "planetary gang rape for profit?" Sorry, enough all ready.
Dear Dr Rose. I read your most recent email commentary on epigenetics. (I am a medical doctor -- a non-scientist by fault of having gone through medical school and two residencies -- and long deprogrammed by just learning to question things!) I just wanted to chime in and say that i love your posts. I love the education you're giving all of us. And I love your courage to step out and speak out. Thank you, dear doctor! The information you have given me, along with people like Steve Kirsch, Joseph Mercola, Pierre Kory, Peter McCullough, and others, have been a god-send to a "country doctor" like me who needs the science to back up my anti-SARS gene jab education to my patients, and to some of my deaf colleagues. I appreciate you so much, all the way down here in Texas. Dr Ron
“I, personally, am absolutely sure contain epigenetic factors causing all of the above, including cancer, by epigenetic modification.”
Dr Rose: do you believe this was intentional? If so, why was this done?
Thx.
This is a great article, thank you Jessica. I'm sharing far and wide. I really appreciate the added graphics and videos ;-) ....really helps those of us who are far less "science minded" peeps.
I think we are all still stuck on the idea that the Japanese worker just coughed his flu bugs into Homer’s juicer and wanting to know the outcome of this dastardly event. Everything else is just so complicated. 😂 Kidding aside what a horrifying article Dr Rose. Makes me glad I’m not injected! Thank you!
I suspect the author retracted his article on DNA repair after the Davos gang made him an offer he could not refuse. When Michael Corleone realizes what has happened to him and his kids and grandbambinos, I would not be surprised if Billy wakes up one morning to find Klaus and Tony's heads next to him under the sheets. (of course I cannot condone this but I would understand).
Thanks for this article. As a layman who has been reading about epigenetics, mitochondrial disease, chemical mutagens and systemic inflammation for the last five years or so. The jabs scared the shit out of me for this reason.
Epigenetics is complicated. Small causes have large effects and this drug by its design looks like it is full of those small causes, lots of them. And without a crystal ball who knows what will eventuate. Cancers. Birth defects. Metabolic diseases. Chronic fatigue.
I ain't putting that crap in my body.
Jessica, This is an excellent piece as is most of your work. Generally apocryphal academic MD here (tenured so hard to assail) who has been a long-time journal editor. Want some copy editing? Would be happy to do so. But for starters, it is "alluded" not "eluded"... :) Thanks for all you do. These long-form and referenced pieces are hard to write.
I haven't yet read your article, but I do know that the spike in the vaccine (and possibly the spike in the virus itself) will tend to cause chronic systemic inflamation. Such inflamation is a strongly contributing factor to most or all of the diseases of old age -- cancer, Alzheimers, arthritis, cariovascular, et al.
The ENTIRE spike (epecially the NTD domain) should NEVER have been used in the vaccine.
One of the many deliberately concealing actions of one of the Trial organizers (with either the BioNTech or Moderna vaccine) was to kill the mice or rats two weeks after the observations, thus preventing any feedback about long-term adverse (or beneficial) effects. For this, we will be including them among the possible Nuremberg Trials II defendants. If it was a deliberate effort to make sure the vaccine was approved, rather than mere stupidity, then we will include them as defendents.
As always, I thank you, Jessica, for your insightful work, and I look forward to reading this particular article tonight.
One thing that anti-vaxers (most of whom lack scientific knowledge) intuitively understand is that "too much of a good thing is bad." The neuro-microbiota-immune system is incomprehensibly complex. And all the diseases of old age are adversely affected by out-of-balance or out-of-control immunity. Therefore, one vaccine (let's say, smallpox) is extraordinarily good. Two (let's say, polio) are also very good. Three, good. Four, good. Five... we need to begin questioning, not the effect of ANY ONE but rather the effect of ALL on the organism's health. Twenty or thirty? Really!
Here, as everywhere in biology, what matters is the entire network. Not an individual node. The anti-vaxers (idiot-savants, perhaps?) intuitively understand this. The knee-jerk lemming little fascists, not so.
On topic of inflammatory disease, you once made reference to curing your own “illness induced asthma”. Could you please share that approach sometime? Our young children have “illness induced asthma” and use Flovent/Albuterol inhalers during cold season. They had regular US vax schedule until age 7 (no Covid vax). Would be very grateful to research alternative therapies for this condition. Thank you for your tireless efforts to educate others!
"But I am going to methylate"...
No problem! Some of my best friends are methylated!
(They think I'm nuts when I send them the latest Substack rvelations.)
At first I thought Fauci et al were just ignorant fools. Now, with your research, I realize it started way before public health got involved. Were the researchers, I doubt were idiots, told to ignore certain aspects of the research, actively hide it, or did they really just miss it. I think we can be pretty sure they didn't miss the potential problems. Either of the two remaining would be possible especially with one of my favorites," we were just following orders." Could there have been studies altered before final release? Dr. Rose thank you for all the work.
Whats up wity the spike protein
and other genetic speeling errors
shawn
Aug 2
scientists are saying they are finding random snippets of genetic code in the shots. Imagine this horror story.
Within the vax injectable genetic drug, the manufacturer inserts a number of random codes. ATCAGTCAGGGTGAACTGGGTGG. CCATGGGTACTGATCTAGGCATTGATCTA. ETC…(etc is not a gene code by the way) just trying to make you smile.
Thanks for reading shawn663@substack! Subscribe for free to receive new posts and support my work.
At a future date they want to trigger another pandemic, you know drive the share price.
An incident is promoted by media, WHO/Gates or WHOmever. This time the dreaded ATCAGTCAGGGTGAACTGGGTGG is the terrible code phrase. All are on high alert set your VCR for above mentioned code sequence. If this is found in the test then we can say a positive result. Naturally it will be found we put it there.
Oh my goodness a new pandemic, different codes for different continents/countries, you know just for variety organized by lot number, do we need a librarian?.
Goodness new lockdowns, new/old vaccines. Hold on Hold on we don’t even need a new vax. Its just random code we installed in the previous shot. A three dressed up as a nine you might say. Just add water to the old vax, instant potatoes so to speak(thats the proper spelling Clinton Foundation) more deaths from social isolation, more profits, this years lambourgini(?).
Great Jimminy Cricket zippidy do da zippidy yay, what a wonderful day.
Impossible,,hmmmmm injecting kids with a pseudo vax that can have serious outcomes including death,,,,now thats impossible! These guys are peeing me off.
Did I say VCR meant to say PCR but it really is a horror movie. ok ok stand up aint my thing.
I have a screen writer friend maybe a movie here,,, we can all star as the good guys you know the natural human immune system, I call T Cell.
IVERMECTIN/HYDROXY work, we knew, the WHO knew, when did they know, who suppressed it.
Shawn663
My brain hurts
Are you able to obtain the original peer review of the Hui Jiang article? Occasionally I have seen the entire review and revision commentary and, for a non-specialist, it added considerably to my appreciation of the article.
Mein Gott!!!
You made an egregious error!!!!!
.../wait for it.././.
it's "alluded" not eluded.
Aside from that spot on! Thanks!!
Thank you for pointing us to Stephanie Seneff + glyphosate + shikimate pathway
Really can't thank you enough. I have learned some about this disaster over the years. Now I can find it all in nearly one place. Nice to add her name to Rachael Carson's.
In the USA late 1960s early 1970 our health and longevity was about 4th in the world. Now it is 79th and falling like a rock. By scanning some articles by Stephanie Seneff I saw that glyphosate was introduce to the world in 1974. My speculation at the moment is it may be a primary cause for the dramatic decline in health in the USA and most likely the world.
A particularly disturbing trend is to eliminate the control group. Mass injectable therapeutic gene therapies do this by compelling` everyone on the planet to be jxbbed. No outliers. It appears to have already happen with glyphosate without anyone being alerted to this process and no control land, air and water ways set aside as safe havens/control groups or groups of people who could truly opt out of being poisoned.
You have been slandered by Droit (I hope I spelled her name right) and it was compared and rightly so to rape or as the good doctor said "gang rape". What the hell is glyphosate if it isn't "planetary gang rape for profit?" Sorry, enough all ready.
In Stephanie's youth... https://stephanieseneff.net/ she looks like you. Her hair is darker.